View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_84 (Length: 253)
Name: NF5746_low_84
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 4202371 - 4202594
Alignment:
| Q |
1 |
attttgtaaaacaaa--ttcaaaacacgaagctaaaacatgaattgttcgatcaacatcagacgatataaatctcaaaccgcgtggttgcatgaatgcag |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||| ||||||||||||| ||||||| |
|
|
| T |
4202371 |
attttgtaaaacaaaaattcaaaacacgaagctaaaacatgaattgttagatcaacatcagacaatataa-tctcaaatcgcgtggttgcataaatgcag |
4202469 |
T |
|
| Q |
99 |
caaatccattaaggaacaaattagtgttccttttgtatacaatactaatgtgacaatgaatataaaaaacatatagtctatgtttagtattacaaatgaa |
198 |
Q |
| |
|
| || |||||||||||||||||| |||||| | |||||||||||||||||||| ||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
4202470 |
ccaacccattaaggaacaaattaatgttccctgcatatacaatactaatgtgacatcaaatat-aaaaacatagagtctatgtttggtattacaaatgaa |
4202568 |
T |
|
| Q |
199 |
tgtcagaatcacggtaacccacttga |
224 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
4202569 |
tgtcagaattacggtaacccacttga |
4202594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University