View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_91 (Length: 244)
Name: NF5746_low_91
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_91 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 7906550 - 7906323
Alignment:
| Q |
1 |
cacagagattatttcggaagctgaagctagaaagtgttgttattcagcgtcgatggatgagcacggtgatgagtttcggcgacggaacccacggagcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906550 |
cacagagattatttcggaagctgaagctagaaagtgttgttattcagcgtcgatggatgagcacggtgatgagtttcggcgacggaacccacggagcact |
7906451 |
T |
 |
| Q |
101 |
cggtttaccaacaaccaccgtcggtataggaacacatgcatacgaaccaacaccaattccatctcttccttccgacattctcaccgtccacgccggtcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906450 |
cggtttaccaacaaccaccgtcggtataggaacacatgcatacgaaccaacaccaattccatctcttccttccgacattctcaccgtccacgccggtcac |
7906351 |
T |
 |
| Q |
201 |
taccactccctcgcaaccacttcccaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7906350 |
taccactccctcgcaaccacttcccaag |
7906323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University