View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_92 (Length: 243)
Name: NF5746_low_92
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 32390001 - 32390235
Alignment:
| Q |
1 |
gcaaaataaatcggaacaaattagttcggaacctcttt--agtttgttaagaattttctttggagagtcgcacgaggttgcctaccaacgcgagttcgtt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32390001 |
gcaaaataaatcggaacaaattagttcggaacctctttgcactttgttaagaattttctttggagagtcgcacgaggttgcctaccaacgcgagttcgtt |
32390100 |
T |
 |
| Q |
99 |
tacagaccaagggtgtcttatttccgctgcaatgccagctttgtaacgaacatgagaatagcctgcatgcgatcttcctgtgtagtaatatcagacagtg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32390101 |
tacagaccaagggtgtcttatttccgctgcaatgccagttttgtaacgaacatgaggatagcctgcattcgatcttcctgtgtagtaatatcagacagtg |
32390200 |
T |
 |
| Q |
199 |
ctggaagcggactggcctttggagtttaatctctg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32390201 |
ctggaagcggactggcctttggagtttaatctctg |
32390235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University