View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5746_low_93 (Length: 240)

Name: NF5746_low_93
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5746_low_93
NF5746_low_93
[»] chr5 (2 HSPs)
chr5 (79-161)||(43289365-43289445)
chr5 (178-221)||(43289316-43289361)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 79 - 161
Target Start/End: Complemental strand, 43289445 - 43289365
Alignment:
79 aagaggaatgattggtgaagttccgattctggttatcgcgttgctttcattcattgcttgctttattattctcagtcactgag 161  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||    
43289445 aagaggaatgattggtgaagttccgattctggttatcgcgttgctttcattcattgcttgctttattat--tcagtcactgag 43289365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 221
Target Start/End: Complemental strand, 43289361 - 43289316
Alignment:
178 ggaaggagcgagaagtaacata--acattacttcctcatctctttt 221  Q
    |||||||||||| |||||||||  ||||||||||||||||||||||    
43289361 ggaaggagcgagcagtaacatataacattacttcctcatctctttt 43289316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University