View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_99 (Length: 236)
Name: NF5746_low_99
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_99 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1543976 - 1544196
Alignment:
| Q |
1 |
cacttgaatatctctctctctggttttgattctcagcacaaactgcaaactaggattgaaattgaaagctttcaagtggttattatgggtcaagcttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1543976 |
cacttgaatatctctctctctggttttgattctcagcacaaactgcaaactaggattgaaattgaaagctttcaagtggttattatgggtcaagcttttc |
1544075 |
T |
|
| Q |
101 |
ggaagctgtttgacaccctctttggcaataccgagatcagggtatcaaccatcaactactttttctttgaaatttgtttgtttccttgcttattctaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1544076 |
ggaagctgtttgacaccctctttggcaataccgagatcagggtatcaaccatcaactactttttctttgaaatatgtttgtttccttgcttattctaatt |
1544175 |
T |
|
| Q |
201 |
atcttcttctgatcacaggtt |
221 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
1544176 |
ctctgcttctgatcacaggtt |
1544196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 27 - 221
Target Start/End: Original strand, 1547861 - 1548057
Alignment:
| Q |
27 |
tgattctcagcacaaactgcaaactagg--attgaaattgaaagctttcaagtggttattatgggtcaagcttttcggaagctgtttgacaccctctttg |
124 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1547861 |
tgattctcagcacaaattgcaaactagagaattgaaattgaaagctttcaagtggttattatgggtcaagcttttcggaagttgtttgacaccctctttg |
1547960 |
T |
|
| Q |
125 |
gcaataccgagatcagggtatcaaccatcaactactttttctttgaaatttgtttgtttccttgcttattctaatgatcttcttctgatcacaggtt |
221 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
1547961 |
gcaataccgagatcggggtatcaaccatcaactactttttctttgaaatatgtttgtttccttgcttattctaattctctgcttctgatcacaggtt |
1548057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University