View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5747_low_2 (Length: 436)
Name: NF5747_low_2
Description: NF5747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5747_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 2e-90; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 155 - 331
Target Start/End: Original strand, 40005668 - 40005844
Alignment:
| Q |
155 |
tcatgcattgcagaggattgtacctaatggtgaatcttttggtgtggacaagctttttgatgaaactgctggctatattgttgctttgcagtatcaagtc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40005668 |
tcatgcattgcagaggattgtacctaatggtgagtcttttggtgtggacaagctttttgatgaaactgctggctatattgttgctttacagtatcaagtc |
40005767 |
T |
|
| Q |
255 |
aaagcattgaaagctcttactggtttctttgaaaagttggagaaggacaagactaaacttggaggttgatagatata |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005768 |
aaagcattgaaagctcttactggtttctttgaaaagttggagaaggacaagactaaacttggaggttgatagatata |
40005844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 10 - 84
Target Start/End: Original strand, 40005523 - 40005597
Alignment:
| Q |
10 |
gcacagaaggtggtggtggcagcaaggaaaagatgttgataaaagaagttgctatgaatgattgtgctgttgagg |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005523 |
gcacagaaggtggtggtggcagcaaggaaaagatgttgataaaagaagttgctatgaatgattgtgctgttgagg |
40005597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 420
Target Start/End: Original strand, 40005898 - 40005933
Alignment:
| Q |
385 |
atggaatgaattccttaggttagagcggttcttttg |
420 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40005898 |
atggaatgaattccttaggttagagaggttcttttg |
40005933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University