View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5747_low_6 (Length: 260)
Name: NF5747_low_6
Description: NF5747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5747_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 92 - 243
Target Start/End: Original strand, 40006145 - 40006297
Alignment:
| Q |
92 |
cttgatagtttattatcatattgtttctaggcaaaa-agaggtttgagtaggtaacatggtattgcatcacacaaatgtagttacgagatttaggaaatt |
190 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006145 |
cttgatagtttattatcatcttgtttctaggcaaaaaagaggtttgagtaggtaacatggtattgcatcacacaaatgtagttacgagatttaggaaatt |
40006244 |
T |
|
| Q |
191 |
tttataggaatcaattttgtgatctttggagtgaagttagaatgggtgaaagt |
243 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40006245 |
tttataggaatcaattttctgatctttggagtgaagttagaatgggtgaaagt |
40006297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University