View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5747_low_8 (Length: 251)
Name: NF5747_low_8
Description: NF5747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5747_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 251
Target Start/End: Original strand, 2064950 - 2065184
Alignment:
| Q |
15 |
actttcgatttgcgttattagttcatcacttaaatttgactattgaataaatctaagtgaatgtacattatttcttggaatcaagttaaggcatgttgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064950 |
actttcgatttgcgttattagttcatcacttaaatttgactattgaataaatctaagtgaatgtacattatttcttggaatcaagttaaggcatgttgtg |
2065049 |
T |
 |
| Q |
115 |
ttcttggaactgaggctcacactcaagttgtgttggaccagtatatctgtgacatgctcaatcatactcataccaccagtatggcagcagaaaatccaga |
214 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065050 |
ttcttggaactgaagctcaca--caagttgtgttggaccagaatatctgtgacatgctcaatcatactcataccaccagtatggcagcagaaaatccaga |
2065147 |
T |
 |
| Q |
215 |
agatgtatgagtcaaagtttgtatatgcatgctggtt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065148 |
agatgtatgagtcaaagtttgtatatgcatgctggtt |
2065184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University