View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5748-Insertion-4 (Length: 363)
Name: NF5748-Insertion-4
Description: NF5748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5748-Insertion-4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 36495941 - 36496060
Alignment:
| Q |
8 |
gtatgtatgaagtaattgcctgcaacattatttaggaacatagagagaattgattttgttcattaatgaccaaatcatgtgtttagacacatcacatact |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36495941 |
gtatgtatgaagtaattgcctgcgacattatttaggaacatagagagtattgattttgttcattaatgaccaaatcatgtgtttagacacatcacatact |
36496040 |
T |
 |
| Q |
108 |
aagtgttagcaatctgattt |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36496041 |
aagtgttagcaatctgattt |
36496060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University