View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5749-Insertion-10 (Length: 177)
Name: NF5749-Insertion-10
Description: NF5749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5749-Insertion-10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 5 - 176
Target Start/End: Complemental strand, 42936612 - 42936441
Alignment:
| Q |
5 |
acactctcaatgctctttcttaccttcatgggcaaggacatcttcatagagatatcaaatccggtaacatccttgctgactcaaatggattagtgaaact |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42936612 |
acactctcaatgctctttcttaccttcatggacaaggacatcttcatagagatatcaaatctggtaacatccttgttgactcaaatggattagtgaaact |
42936513 |
T |
 |
| Q |
105 |
tgcagattttggtgtttctgcttccatttatgaatcaaacaactctgtaggagcatgttcttcttattcatc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42936512 |
tgcagattttggtgtttctgcttccatttatgaatcaaacaactctgtaggagcatgttcttcttattcatc |
42936441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University