View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5749-Insertion-11 (Length: 145)
Name: NF5749-Insertion-11
Description: NF5749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5749-Insertion-11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 2e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 9 - 103
Target Start/End: Complemental strand, 16871806 - 16871712
Alignment:
| Q |
9 |
tactctcgaaaaacaaatgtttttatagatgtgtaaatgggctaatcaatattagtataattcatagtacataagttgagatgattagtgcagaa |
103 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
16871806 |
tactctcgaaaaatattagtttttatagatgtgtaaattggagaatcaatattagtataatacatagtacataagttgagatggttagtgcagaa |
16871712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 16654549 - 16654597
Alignment:
| Q |
9 |
tactctcgaaaaacaaatgtttttatagatgtgtaaatgggctaatcaa |
57 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||||||||||||| |
|
|
| T |
16654549 |
tactctcgaaaaatatgtgattttatagatgtgtaaatgggctaatcaa |
16654597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University