View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5749_high_27 (Length: 258)
Name: NF5749_high_27
Description: NF5749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5749_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 21 - 250
Target Start/End: Complemental strand, 6068215 - 6067986
Alignment:
| Q |
21 |
gtgggatcaagggagaactagttagtgagctagaatatggttaccgcattttagggagggggatcttagtcatttagcctttatatgattcaacaagagg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068215 |
gtgggatcaagggagaactagttagtgagctagaatatggttaccgcattttagggagggggatcttagtcatttagcctttatatgattcaacaagagg |
6068116 |
T |
|
| Q |
121 |
agtgtgggaatcattcagttttatggttgatagttgtggttaggagagttctctctctagtaggagctatgctttggaataggatcctttgactctggtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6068115 |
agtgtgggaatcattcagttttatggttgatagttgtggttaggagagttctctctctagtaggagttatgctttggaataggatcctttgactctggtt |
6068016 |
T |
|
| Q |
221 |
atcgctttcgtcgttgtagagcttcatatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6068015 |
atcgctttcgtcgttgtagagcttcatatc |
6067986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 88
Target Start/End: Original strand, 48625313 - 48625360
Alignment:
| Q |
42 |
ttagtgagctagaatatggttaccgcat-tttagggagggggatctta |
88 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
48625313 |
ttagtgagctagaatatggttaccgcatctgtagggaggggaatctta |
48625360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University