View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5749_high_27 (Length: 258)

Name: NF5749_high_27
Description: NF5749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5749_high_27
NF5749_high_27
[»] chr8 (1 HSPs)
chr8 (21-250)||(6067986-6068215)
[»] chr4 (1 HSPs)
chr4 (42-88)||(48625313-48625360)


Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 21 - 250
Target Start/End: Complemental strand, 6068215 - 6067986
Alignment:
21 gtgggatcaagggagaactagttagtgagctagaatatggttaccgcattttagggagggggatcttagtcatttagcctttatatgattcaacaagagg 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6068215 gtgggatcaagggagaactagttagtgagctagaatatggttaccgcattttagggagggggatcttagtcatttagcctttatatgattcaacaagagg 6068116  T
121 agtgtgggaatcattcagttttatggttgatagttgtggttaggagagttctctctctagtaggagctatgctttggaataggatcctttgactctggtt 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
6068115 agtgtgggaatcattcagttttatggttgatagttgtggttaggagagttctctctctagtaggagttatgctttggaataggatcctttgactctggtt 6068016  T
221 atcgctttcgtcgttgtagagcttcatatc 250  Q
    ||||||||||||||||||||||||||||||    
6068015 atcgctttcgtcgttgtagagcttcatatc 6067986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 88
Target Start/End: Original strand, 48625313 - 48625360
Alignment:
42 ttagtgagctagaatatggttaccgcat-tttagggagggggatctta 88  Q
    |||||||||||||||||||||||||||| | |||||||||| ||||||    
48625313 ttagtgagctagaatatggttaccgcatctgtagggaggggaatctta 48625360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University