View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5749_low_11 (Length: 407)
Name: NF5749_low_11
Description: NF5749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5749_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 3e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 180 - 390
Target Start/End: Original strand, 32794050 - 32794261
Alignment:
| Q |
180 |
tcgagaaccctcaacaatcaaaattatatcataaatcagttggtcaagcacaactttttcgccaaaacaaatagtaa-ctaaattgacaaa-ggtcattc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
32794050 |
tcgagaaccctcaacaatcaaaattatatcataaatcagttggtcaagtacaactttttcgccaaaacaaatagtaaactaaattgacaaaaggccattc |
32794149 |
T |
|
| Q |
278 |
tccaaaatggaataaaatttagttatccgacattcccttttttcccataataataattttctgttatagaacatttgtatatcttcttttttgacacttt |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
32794150 |
tccaaaatggaataaaatttagttatccgacattcccttttttcccataataataattttctgttatagaacatttgtgtatcttc-tttttgacacttt |
32794248 |
T |
|
| Q |
378 |
ggtgaatgtttgt |
390 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32794249 |
ggtgaatgtttgt |
32794261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University