View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5749_low_16 (Length: 346)
Name: NF5749_low_16
Description: NF5749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5749_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 7 - 197
Target Start/End: Complemental strand, 3346792 - 3346602
Alignment:
| Q |
7 |
tcgaagaaaattatggacaaaagaaattgtgttgcttatcttatggaataaagatagaaatttcgttattagtttttgcctaaagaaagagagacatttt |
106 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3346792 |
tcgaaaaaaattatgaacaaaagaaattgtgttgcttatcttatggaataaagatagaaatttcgttattagtttttgcctaaagaaagagagacatttt |
3346693 |
T |
 |
| Q |
107 |
ttctaatgaggttgaaagcatcataatattttattagtatgatgttgctaatccaatctaaattaaggattaaaaatacgagtaagcatat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3346692 |
ttctaatgaggttgaaagcatcataatattttattagtatgatgttgctaatccaatctaaattaaggattaaaaatacgagtaagtatat |
3346602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 268 - 346
Target Start/End: Complemental strand, 3346532 - 3346454
Alignment:
| Q |
268 |
caattgtgaacatcatattaatatgcaacattagttagttataaacaacttggcatgttatgagagagccagatgtatt |
346 |
Q |
| |
|
|||||||||| |||||| || | ||||||| ||||||| ||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
3346532 |
caattgtgaaaatcatagtagtgtgcaacactagttagctataagcaacttggcatgttatgagagagcaagatgtatt |
3346454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University