View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5749_low_30 (Length: 256)
Name: NF5749_low_30
Description: NF5749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5749_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 30 - 248
Target Start/End: Complemental strand, 10252494 - 10252267
Alignment:
| Q |
30 |
gatagaaagtagaagttatattcct--gattttcaatcttgagattcagatatgattgtg-cttctactttctatcgt------gttatgagtgatgtct |
120 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||| |||||||||| |
|
|
| T |
10252494 |
gatagaaaatagaagttataatcctctgattttcaatcttgagattcagatatgattgtggcttctactttctatcattaattcgttataagtgatgtct |
10252395 |
T |
|
| Q |
121 |
ttattatgtgagaatcaaatattttaaaatccttataatttataannnnnnnaacctaaaaatgaatgtaaaaactataacttacaattatattataagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10252394 |
ttattatgtgagaatcaaatattttaaaatccttataattcataatttttttaacctaaaaatgaatgtgaaaactataacttacaattatattataagt |
10252295 |
T |
|
| Q |
221 |
ggtagcatgaacttactaaacctttgat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10252294 |
ggtagcatgaacttactaaacctttgat |
10252267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University