View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5750-Insertion-4 (Length: 61)
Name: NF5750-Insertion-4
Description: NF5750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5750-Insertion-4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 33126333 - 33126279
Alignment:
| Q |
7 |
acacccaacactagacatgccacttatagattatgatcttgctttgctcttccag |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126333 |
acacccaacactagacatgccacttatagattatgatcttgctttgctcttccag |
33126279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 7569014 - 7569066
Alignment:
| Q |
9 |
acccaacactagacatgccacttatagattatgatcttgctttgctcttccag |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
7569014 |
acccaacactagacatgccacttatagattatgatttggctttgcttttccag |
7569066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University