View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5750-Insertion-4 (Length: 61)

Name: NF5750-Insertion-4
Description: NF5750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5750-Insertion-4
NF5750-Insertion-4
[»] chr8 (1 HSPs)
chr8 (7-61)||(33126279-33126333)
[»] chr5 (1 HSPs)
chr5 (9-61)||(7569014-7569066)


Alignment Details
Target: chr8 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 33126333 - 33126279
Alignment:
7 acacccaacactagacatgccacttatagattatgatcttgctttgctcttccag 61  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33126333 acacccaacactagacatgccacttatagattatgatcttgctttgctcttccag 33126279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 7569014 - 7569066
Alignment:
9 acccaacactagacatgccacttatagattatgatcttgctttgctcttccag 61  Q
    ||||||||||||||||||||||||||||||||||| | |||||||| ||||||    
7569014 acccaacactagacatgccacttatagattatgatttggctttgcttttccag 7569066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University