View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751-Insertion-8 (Length: 294)
Name: NF5751-Insertion-8
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751-Insertion-8 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 47 - 294
Target Start/End: Complemental strand, 36474942 - 36474698
Alignment:
| Q |
47 |
tattttcaaacaaaagaaaaatgtggttattatattttggaaggattacatcctaagtggtttgaattctccaaaccctaggtttgtgaagaattgttta |
146 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474942 |
tattttcaaacaaaagaaaaatatggttattatattttggaaggattacatg---agtggtttgaattctccaaaccctaggtttgtgaagaattgtttg |
36474846 |
T |
 |
| Q |
147 |
atgctcttttgaagattgcctcacaatgagacccctgcaaccgttttacctcatatgtcagcgttccaagatgccatcaccatgttaatgagatctgaca |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474845 |
atgctcttttgaagattgcctcacaatgagacccctgcaaccgttttacctcatatgtcagcgttccaagatgccatcaccatgttaatgagatctgaca |
36474746 |
T |
 |
| Q |
247 |
atactcttgacatgcgcattgccacgctttttgctgctatcaacctcc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474745 |
atactcttgacatgcgcattgccacgctttttgctgctatcaacctcc |
36474698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 36474996 - 36474956
Alignment:
| Q |
7 |
aaaaactacactgaataagagagcaacggaatcatcatatt |
47 |
Q |
| |
|
|||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
36474996 |
aaaaactacactaactaagagggcaacggaatcatcatatt |
36474956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University