View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751-Insertion-9 (Length: 215)
Name: NF5751-Insertion-9
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751-Insertion-9 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 123 - 215
Target Start/End: Complemental strand, 883505 - 883413
Alignment:
| Q |
123 |
acttatccatctcatacaacgtagcaacggcgagctggctccatcatcctccattcctgttaaagacccctctcatatccgcttaggccatca |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
883505 |
acttatccatctcatacaacatagcaacggcgagctggctccatcatcctccattcctgttaaagacccctctcatatccgcttaggccatca |
883413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 883614 - 883523
Alignment:
| Q |
8 |
atcacttgttgatttgaatgagttatcagatgtttgggtttgaggaagttgagacccctgactttggagagttaaaggttatatggttgcgc |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
883614 |
atcacttgttgatttgaacgagttatcagatgtttgggtttgaggaagttgagacccctgactttggagagttaaagattatatggttgcgc |
883523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University