View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_high_25 (Length: 292)
Name: NF5751_high_25
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 25121321 - 25121535
Alignment:
| Q |
19 |
acaaagatcatctcaagaagacaaagatgatgatattaatgttgctactttggaagagacaagttcttatctttctttggatttgaatatttctattgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25121321 |
acaaagatcatctcaagaagacaaagatgatgatattaatgttgctactttggaagagacaagttcttatgtttctttggatttgaatatttctattgat |
25121420 |
T |
|
| Q |
119 |
gaggattacaatgaggatgataaattggttgatgaaattgggctacttgaatccgtagacagaaagattctcttcaaaattcaagaattatgaagaaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25121421 |
gaggattacaatgaggatgataaattggttgatgaaattgggctacttgaatccgtagacagaaagattctcttcaaaattcaagaattatgaagaaaat |
25121520 |
T |
|
| Q |
219 |
ttcttgaacacagcc |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25121521 |
ttcttgaacacagcc |
25121535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 251 - 282
Target Start/End: Original strand, 25121554 - 25121585
Alignment:
| Q |
251 |
ttcttctagctaggtatttcttatttcctatg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25121554 |
ttcttctagctaggtatttcttatttcctatg |
25121585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University