View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_high_37 (Length: 255)
Name: NF5751_high_37
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 42846026 - 42845781
Alignment:
| Q |
1 |
ttttgcttagtcaggtgaaacatctctcagccacacaagatcagtagccctgtgtgcatcaacgagtagattcaggtaggaaactctgaataagttctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42846026 |
ttttgcttagtcaggtgaaacatctctcagccacacaagatcagtagccctgtgtgcatcaacgagtagattcaggtaggaaactctgaataagttctgc |
42845927 |
T |
|
| Q |
101 |
aagcatgttatccatgcctctttctttgagtgctcagcaatttcattgacgtttgcacggctcatagcctcccagtacaaaaaatccattgtcatttctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845926 |
aagcatgttatccatgcctctttctttgagtgctcagcaatttcattgacgtttgcacggctcatagcctcccagtacaaaaaatccattgtcatttctg |
42845827 |
T |
|
| Q |
201 |
tcttttctctcttccctgccttagctgcttgtgcatgtatattctt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845826 |
tcttttctctcttccctgccttagctgcttgtgcatgtatattctt |
42845781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 94 - 226
Target Start/End: Complemental strand, 41980056 - 41979923
Alignment:
| Q |
94 |
gttctgcaagcatgttatccatgcctctttctttgagtgc-tcagcaatttcattgacgtttgcacggctcatagcctcccagtacaaaaaatccattgt |
192 |
Q |
| |
|
|||| ||||||||||| | |||||| || ||||||| ||| ||||||||||| ||||||||||| || |||| ||| ||||||| ||| | ||||| | |
|
|
| T |
41980056 |
gttcagcaagcatgttgttcatgcccctctctttgattgcatcagcaatttccttgacgtttgcccgtctcacagcttcccagtccaatgagtccatgtt |
41979957 |
T |
|
| Q |
193 |
catttctgtcttttctctcttccctgccttagct |
226 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| |
|
|
| T |
41979956 |
gctttctgtcttttctctcttcccagccgtagct |
41979923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 41980247 - 41980173
Alignment:
| Q |
2 |
tttgcttagtcaggtgaaacatctctcagccacacaagatcagtagccctgtgtgcatcaacgagtagattcagg |
76 |
Q |
| |
|
||||||| |||||||| ||||||||| |||||| | |||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
41980247 |
tttgcttggtcaggtggaacatctctaagccactcgagatcaatagccccgtgtttttcaacgagtagattcagg |
41980173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University