View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_high_40 (Length: 250)
Name: NF5751_high_40
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 85 - 236
Target Start/End: Original strand, 525925 - 526076
Alignment:
| Q |
85 |
ccactaaacaaatgctaccgatggaggattgcgacataagatattttattaactaattgagtaactaactaattcttattaatcaactaattctaacaat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
525925 |
ccactaaacaaatgctaccgatggaggattgcgacataagatattttattaactaattgagtaactaactaattcttattaatcaactaattctaacaat |
526024 |
T |
 |
| Q |
185 |
ctcaacacttataatatctcttttagttgtttttgtgtgatggatgatattg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
526025 |
ctcaacacttataatatctcttttagttgtttttgtgtgatggatgatattg |
526076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University