View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_high_47 (Length: 236)
Name: NF5751_high_47
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 51459241 - 51459457
Alignment:
| Q |
1 |
tgtccacacaaaaagttcaaacaaacagtgtactacgtaacgtgttatttcgttcactttcatcattgacccatataattctctatnnnnnnnnccattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
51459241 |
tgtccacacaaaaagttcaaacaaacagtgtactacgtaacgtgttatttcgttcactttcatcattgacccatataatcctctataaaaaaaaccattc |
51459340 |
T |
|
| Q |
101 |
actcatataactatggttgaatgggaatgagtcaaaatatattgatannnnnnnnnncgaggtacaaatatattgataacttaaaattaaaacccacttc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
51459341 |
actcgtataactatggttgaatgggaatgagtcaaaatatattgatattttttttttcgaggtacaaatatattgataac------ttaaaacccaattc |
51459434 |
T |
|
| Q |
201 |
actaaaattgggatattttttat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51459435 |
actaaaattgggatattttttat |
51459457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University