View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_high_49 (Length: 218)
Name: NF5751_high_49
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_high_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 26516600 - 26516415
Alignment:
| Q |
16 |
caaccttcatttggagaaacatttatatactatgattcagcgacagtacttccaaaatgtattattatcattatttaaaaattgcagccgcaatataaca |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||| |||||||| || ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26516600 |
caaccttcatttggagaaacatttacatactatgattcagtgacagcacttccaagatatattattatcattatttaaaaattgcagctgcaatataaca |
26516501 |
T |
|
| Q |
116 |
gttttagaactctctgcagcaacactgccattgtggttgcatcagtcatatttgtctgcattttattgcaatatgaagattgcagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26516500 |
gttttagaactctctgcagcaacactgcaattgtggttgcatcagtcatatttgtctgcattttattgcaatatgaagattgcagt |
26516415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 94 - 123
Target Start/End: Complemental strand, 7259537 - 7259508
Alignment:
| Q |
94 |
aaattgcagccgcaatataacagttttaga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7259537 |
aaattgcagccgcaatataacagttttaga |
7259508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University