View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_high_50 (Length: 218)
Name: NF5751_high_50
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_high_50 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 11 - 218
Target Start/End: Original strand, 24913878 - 24914085
Alignment:
| Q |
11 |
cataggacttgtactgctatgctttattataaatagactaatagtaat---aaacaactaaaaactgttgacaacttactcatgcaaaaattggccgaaa |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24913878 |
cataggacttgaactgctatgctttattataaatagactaataataataataaacaactaaaaactgttgacaacttactcatgcaaaaattggccgaaa |
24913977 |
T |
|
| Q |
108 |
aaattgatctcatgctccatgaactagcaaagaaacgnnnnnnnntgatatcggtaagtattacagccatgggttaagaatgcaaacaatatagatataa |
207 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24913978 |
aatttgatctcatgctccgtgaactagcaaagaaacg-aaaaaaatg--atcggtaagtattacagccatgggttaagaatgcaaacaatatagatataa |
24914074 |
T |
|
| Q |
208 |
gattgaaaacc |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
24914075 |
gattgaaaacc |
24914085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 24913682 - 24913751
Alignment:
| Q |
17 |
acttgtactgctatgctttattataaatagactaatagtaataaacaactaaaaactgttgacaacttac |
86 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
24913682 |
acttgtaatactatgctttattatagatagactaatatttataaacaactaaaaactgtttacaacttac |
24913751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University