View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_high_52 (Length: 204)
Name: NF5751_high_52
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_high_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 4215840 - 4215659
Alignment:
| Q |
1 |
ggagaaggataattaggaatagaaggaggagtagaaggaaaacataacttatagtaatcaggacaatctatttgaaagaacaaacacatcttatacaaaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4215840 |
ggagaaggataattaggagtagaaggaggag---aaggaaaacataacttatagtaatcaggacaatctatttgaaagaacaaacacatcttatacaaaa |
4215744 |
T |
 |
| Q |
101 |
acaaacaaccgaacgttttttcagatttgtaaatatcatcgtctttctttggttgatttcttgttcctgcaccctcagcacaata |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
4215743 |
acaaacaaccgaacgttttttcagatttgtaaatatcatcgtctttctttggttgattacttgtttctgcaccctcagcacaata |
4215659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University