View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_low_16 (Length: 376)
Name: NF5751_low_16
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 18 - 365
Target Start/End: Original strand, 39562906 - 39563253
Alignment:
| Q |
18 |
acaccttaattgtaatcattttttagagaactcagctttatcatcctttatcacacaggttggctatgataaattaggtttacccattggtcttcagttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39562906 |
acaccttaattgtaatcattttttagagaactcagctttatcatcctttatcacacaggttggctatgataaattaggtttacccattggtcttcagttt |
39563005 |
T |
 |
| Q |
118 |
ataggaaggccttgggctgaggcaacattgatccacttggcatttgcaatgcaggtaaatgaatagtgaataacttgctttgtaagataataaaatatag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39563006 |
ataggaaggccttgggctgaggcaacattgatccacttggcatttgcaatgcaggtaaatgaatagtgaataacttgctttgtaagataataaaatatag |
39563105 |
T |
 |
| Q |
218 |
tatatgtgactagtaaattttttattgagtggtgatgatccacactcaagaaaatgaagtttttgtatgaatctgttttgtacctaatttgagtgagtac |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39563106 |
tatatgtgactagtaaaatttttattgagtggtggtgatccacactcaagaaaatgaagtttttgtatgaatctgttttgtacctaatttgagtgagtac |
39563205 |
T |
 |
| Q |
318 |
taacattatggtgttgttatgatctcagaccatatgcttgtcagaata |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39563206 |
taacattatggtgttgttatgatctcagaccatatgcttgtcagaata |
39563253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 71 - 176
Target Start/End: Original strand, 44423707 - 44423812
Alignment:
| Q |
71 |
cacaggttggctatgataaattaggtttacccattggtcttcagtttataggaaggccttgggctgaggcaacattgatccacttggcatttgcaatgca |
170 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || ||||||||||| ||||| |||||||||||| |||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
44423707 |
cacaggttgggtatgataaatttggtttgcctattggtcttcaatttattggaaggccttggtctgaagcaacactaatccacttggcatttgcaatgca |
44423806 |
T |
 |
| Q |
171 |
ggtaaa |
176 |
Q |
| |
|
|||||| |
|
|
| T |
44423807 |
ggtaaa |
44423812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University