View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_low_30 (Length: 283)
Name: NF5751_low_30
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 2298821 - 2298998
Alignment:
| Q |
1 |
ctgaagttttgatcaagataatttcactatcaaacacaatggacctggtcttcgatcaatggctaatggtattagttctttata-catgataaatgagtt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2298821 |
ctgaagttttgatcaagataatttcactatcaaacacaatggacctggtcttcgatcaatggcaaatggtattagttctttataacatgataaatgagtt |
2298920 |
T |
 |
| Q |
100 |
actcaacttctcactatctcattttaaacactactttgtgtggttcatatgatgaatgagtttaatcgtaggagtttg |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2298921 |
actcaacttctcactatctcatttataacactactttgtgtggttcatatgatgaatgagtttaattgtaggagtttg |
2298998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 172 - 283
Target Start/End: Original strand, 2299044 - 2299155
Alignment:
| Q |
172 |
agtttgcccatactaaggtttttcgttcctgtttgcaggtcacatttgccacactatattgtcagtttttaatccatttacatgtcagaagttttgttgt |
271 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2299044 |
agttcgcccatactaaggtttttcgttcatgtttgcaggtcacatttgccacactatattgtcagttttccatccatttacatgtcagaagttttgttgt |
2299143 |
T |
 |
| Q |
272 |
aatgggtctagc |
283 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2299144 |
aatgggtctagc |
2299155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University