View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_low_37 (Length: 256)
Name: NF5751_low_37
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 8 - 241
Target Start/End: Original strand, 2835747 - 2835981
Alignment:
| Q |
8 |
gaaacagattctgtagactaatttaaccagtatctcactatgtcattcnnnnnnnnnn-aaccatccggttcctaagggaagggtactctgaaaatccag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2835747 |
gaaacagattctgtagactaatttaaccagtatctcactatgtcattctttttttttttaaccatccggttcctaagggaagggtactctgataatccag |
2835846 |
T |
 |
| Q |
107 |
agttcggccggtaggtaagtaaatcctagaaaaaacatgttccacctaagaatcgaatttaggtactcccgagctatttgcccttaggggagttcagtaa |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2835847 |
agttcggccagtaggtaagtaaatcctagaaaaaacatgttccacctaagaatcgaatttaggtactcccgagctatttgcccttaggggagttcagtaa |
2835946 |
T |
 |
| Q |
207 |
ccacttgagccctattacttggttcactatgtcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2835947 |
ccacttgagccctattacttggttcactatgtcat |
2835981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 133
Target Start/End: Original strand, 34199126 - 34199158
Alignment:
| Q |
101 |
atccagagttcggccggtaggtaagtaaatcct |
133 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
34199126 |
atccagagttcggccgggaggtaagtaaatcct |
34199158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University