View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_low_43 (Length: 245)
Name: NF5751_low_43
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 35034773 - 35035001
Alignment:
| Q |
1 |
tatggctatataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaataccatgatgcaacctttcttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034773 |
tatggctatataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaataccatgatgcaacctttcttga |
35034872 |
T |
|
| Q |
101 |
acatgacgggtaacaccatgatgcaaccttacagacccataagcgaacaaaattttctagaacgtcgtgtttcaactccaactcctattggtacaaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034873 |
acatgacgggtaacaccatgatgcaaccttacagacccataagtgaacaaaattttctagaacgtcgtgtttcaactccaactcctattggtacaaatca |
35034972 |
T |
|
| Q |
201 |
agttggacctaatatcaatagggcagttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35034973 |
agttggacctaatatcaatagggcagttc |
35035001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University