View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_low_45 (Length: 242)
Name: NF5751_low_45
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 136
Target Start/End: Original strand, 2298593 - 2298713
Alignment:
| Q |
16 |
aaaagaatataattttagtttattgcagactttttcctcaattgaattttttgtatcttatcaaattggtaataatgtcagccatgttgtttttgttatt |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2298593 |
aaaagaatataatttaagtttattgcagactttttcctcaattgaattttttgtatcttatcaaattggtaataatgtaagccatgttgtttttgttatt |
2298692 |
T |
|
| Q |
116 |
aagatgctatgtttatttcat |
136 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2298693 |
aagatgctatgtttatttcat |
2298713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 150 - 242
Target Start/End: Original strand, 2298742 - 2298834
Alignment:
| Q |
150 |
ttaattggttatgtgactttggacgctgttatctctagaaaagtatagatatgtttctatttgtgtttccatctatggactgaagttttgatc |
242 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2298742 |
ttaatcggttatgtgactttggacgctgttatctctagaaaagtatagatatgtttctatttgtgtttccatctatggactgaagttttgatc |
2298834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University