View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5751_low_52 (Length: 218)

Name: NF5751_low_52
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5751_low_52
NF5751_low_52
[»] chr7 (2 HSPs)
chr7 (11-218)||(24913878-24914085)
chr7 (17-86)||(24913682-24913751)


Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 11 - 218
Target Start/End: Original strand, 24913878 - 24914085
Alignment:
11 cataggacttgtactgctatgctttattataaatagactaatagtaat---aaacaactaaaaactgttgacaacttactcatgcaaaaattggccgaaa 107  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||   |||||||||||||||||||||||||||||||||||||||||||||||||    
24913878 cataggacttgaactgctatgctttattataaatagactaataataataataaacaactaaaaactgttgacaacttactcatgcaaaaattggccgaaa 24913977  T
108 aaattgatctcatgctccatgaactagcaaagaaacgnnnnnnnntgatatcggtaagtattacagccatgggttaagaatgcaaacaatatagatataa 207  Q
    || ||||||||||||||| ||||||||||||||||||        ||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
24913978 aatttgatctcatgctccgtgaactagcaaagaaacg-aaaaaaatg--atcggtaagtattacagccatgggttaagaatgcaaacaatatagatataa 24914074  T
208 gattgaaaacc 218  Q
    |||||||||||    
24914075 gattgaaaacc 24914085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 24913682 - 24913751
Alignment:
17 acttgtactgctatgctttattataaatagactaatagtaataaacaactaaaaactgttgacaacttac 86  Q
    ||||||| | ||||||||||||||| ||||||||||| | |||||||||||||||||||| |||||||||    
24913682 acttgtaatactatgctttattatagatagactaatatttataaacaactaaaaactgtttacaacttac 24913751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University