View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5751_low_54 (Length: 204)

Name: NF5751_low_54
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5751_low_54
NF5751_low_54
[»] chr8 (1 HSPs)
chr8 (1-185)||(4215659-4215840)


Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 4215840 - 4215659
Alignment:
1 ggagaaggataattaggaatagaaggaggagtagaaggaaaacataacttatagtaatcaggacaatctatttgaaagaacaaacacatcttatacaaaa 100  Q
    |||||||||||||||||| ||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4215840 ggagaaggataattaggagtagaaggaggag---aaggaaaacataacttatagtaatcaggacaatctatttgaaagaacaaacacatcttatacaaaa 4215744  T
101 acaaacaaccgaacgttttttcagatttgtaaatatcatcgtctttctttggttgatttcttgttcctgcaccctcagcacaata 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
4215743 acaaacaaccgaacgttttttcagatttgtaaatatcatcgtctttctttggttgattacttgtttctgcaccctcagcacaata 4215659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University