View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5751_low_55 (Length: 204)
Name: NF5751_low_55
Description: NF5751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5751_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 183
Target Start/End: Complemental strand, 384847 - 384683
Alignment:
| Q |
19 |
ttctcctcttcagccttgcaaatgtcctctttgtcgtcatcctattaatcttcttcttcccactgacgttgtcgacaacaacaattatgagcaggatcgt |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
384847 |
ttctcctcttcaaccttgcaaatgtcctctttgtcgtcgtcctattaatcttcttcttcccactgacgttgtcgacaacaacaattatgagcaggatagt |
384748 |
T |
 |
| Q |
119 |
cttctgggtgatattcagaaatataatcgtctttttggtgaacaatctaatgctagtattgctga |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384747 |
cttctgggtgatattcagaaatataatcgtctttttggtgaacaatctaatgctagtattgctga |
384683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 19 - 179
Target Start/End: Complemental strand, 390227 - 390064
Alignment:
| Q |
19 |
ttctcctcttcagccttgcaaatgtcctctttgtcgtcatcctattaatcttcttcttcccactgacgttgtcgacaacaacaattatgagcaggatcgt |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||| ||||||||| |||||| ||||||| ||||| || ||| || ||||| |||||| |||||| |
|
|
| T |
390227 |
ttctcctcttcaaccttgcaaatgtcctctctgtcgtcgtcctattaaccttcttgttcccaccgacgtcgtagacgacgccaattctgagcaagatcgt |
390128 |
T |
 |
| Q |
119 |
ct---tctgggtgatattcagaaatataatcgtctttttggtgaacaatctaatgctagtattg |
179 |
Q |
| |
|
| | ||| ||||||||| | |||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
390127 |
ttgaatttggctgatattcaaagatataaccgtgtttttggccaacaatctaatgctagtattg |
390064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University