View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5752-Insertion-3 (Length: 399)
Name: NF5752-Insertion-3
Description: NF5752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5752-Insertion-3 |
 | |
|
| [»] scaffold0062 (4 HSPs) |
| |
|
Alignment Details
Target: scaffold0062 (Bit Score: 376; Significance: 0; HSPs: 4)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 8 - 399
Target Start/End: Original strand, 5618 - 6009
Alignment:
| Q |
8 |
gtttcgcggagtgcttagggcaagttataacagatctcaagaaagatagagatctgaatatcaatgttgtgtccattgctccatccgagcaaaatgattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5618 |
gtttcgcggagtgcttagggcaagttataacagatctcaagaaagatagagatctgaatatcaatgttgtgtccattgctccatccgagcaaaatgattc |
5717 |
T |
|
| Q |
108 |
gcattaccgcaaattgtattgggaaaacaaggacaatattaatttggttgactacaagttatacaaccaaactaaaattgtacaaacatctgaagaattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5718 |
gcattaccgcaaattgtattgggaaaacaaggacaatattaatttggttgactacaagttatacaaccaaactaaaattgtacaaacatctgaagaattt |
5817 |
T |
|
| Q |
208 |
gtgaaactttattcaaagatagcgaatgactactctcctgaaaaattccttccaggaattagcaccgacccgggtgacaccgagcctgcagataagatta |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5818 |
gtgaaactttattcaaagatagcgaatgactactctcctgaaaaattccttccaggaattagcaccgacccgggtgacaccgagcctgcagataagatta |
5917 |
T |
|
| Q |
308 |
ttaagatgccaagggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgac |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
5918 |
ttaagatgccaagggagatcttcattgctggatgcaaacatcttatgcaatactccacactccctggtatttttctttggaatgctcatgac |
6009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 399
Target Start/End: Original strand, 16242 - 16331
Alignment:
| Q |
310 |
aagatgccaagggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgac |
399 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | || | | ||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
16242 |
aagatgccaagggagcacttcattgctggctgcagacatctcctccagatagcatcactccctggtgtttttctttggaacgctgatgac |
16331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 399
Target Start/End: Original strand, 26410 - 26499
Alignment:
| Q |
310 |
aagatgccaagggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgac |
399 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | || | | ||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
26410 |
aagatgccaagggagcacttcattgctggctgcagacatctcctccagatagcatcactccctggtgtttttctttggaacgctgatgac |
26499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 399
Target Start/End: Original strand, 36576 - 36665
Alignment:
| Q |
310 |
aagatgccaagggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgac |
399 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | || | | ||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
36576 |
aagatgccaagggagcacttcattgctggctgcagacatctcctccagatagcatcactccctggtgtttttctttggaacgctgatgac |
36665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University