View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5752-Insertion-6 (Length: 261)
Name: NF5752-Insertion-6
Description: NF5752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5752-Insertion-6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 8 - 261
Target Start/End: Original strand, 2734794 - 2735047
Alignment:
| Q |
8 |
cgattgactcatcttttgcgacaatgtacatttttaccggtttacctggtactagcggcacgagtactggtggattcacaaaggcatacttgatttgctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2734794 |
cgattgactcatcttttgcgacaatgtacaactttaccggtttacctggtactagtggcacgagtactggtggattcacaaaggcctacttgatttgctt |
2734893 |
T |
 |
| Q |
108 |
aaaggtgttatgttttcggctccccatatcattccctctaagtcctttagtcttagcaatggtgaaaatgacttcatcttgccaatcaaattagatatga |
207 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2734894 |
aatggtgttatgttttcggctccccatatcattccctctaagtcctttagtcttaacaaaggtgaaaatgacttcatcttgccaatcaaattagatatga |
2734993 |
T |
 |
| Q |
208 |
accttcttaggaaacttattttccccgtagagactctgcaacttcttctttgtg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2734994 |
accttcttaggaaacttattttccccgtagagactctgcaacttcttctttgtg |
2735047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University