View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5752-Insertion-7 (Length: 227)
Name: NF5752-Insertion-7
Description: NF5752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5752-Insertion-7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 41594795 - 41594702
Alignment:
| Q |
8 |
gtatgcgccaaattccttacaagaaatccaaaaaatatatattttgatcaaaagaaaaatcattatgattgattattatcatttgattcatgat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41594795 |
gtatgcgccaaattccttacaagaaatccaaaaaatatatattttgatcaaaagaaaaatcattatgattgattattatcatttgattcatgat |
41594702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 125 - 227
Target Start/End: Complemental strand, 41594673 - 41594571
Alignment:
| Q |
125 |
tatgattatactgatccaagtaggtaagggatttaggtttgatgcctcacatggnnnnnnnttggttggaacctgtttttcgacagagagtggaaacttg |
224 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41594673 |
tatgtttatactgatccaagtgggtaagggatttaggtttgatgcctcacatggaaaaaaattgtttggaacctgtttttcgacagagagtggaaacttg |
41594574 |
T |
|
| Q |
225 |
gta |
227 |
Q |
| |
|
||| |
|
|
| T |
41594573 |
gta |
41594571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University