View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5753-Insertion-3 (Length: 256)
Name: NF5753-Insertion-3
Description: NF5753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5753-Insertion-3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 4633958 - 4633710
Alignment:
| Q |
8 |
ataagatggttggcatttaacttgaacaccataagtgactgatgcttttgtaggtgcaatgtacagaaaggaatgaaagcactaactgatgcttttgttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||| |||||| |||||||||||||| |
|
|
| T |
4633958 |
ataagatggttggcatttaacttgaacaccagaagtgactgatgcttttgtaggtgcaatgtacagaaatgaataaaatcactaattgatgcttttgttt |
4633859 |
T |
 |
| Q |
108 |
tgat-------------gttgatatgtttttataggctgcagttgcacattttctaaatagatataaaaatgtggcatcgtaattggatttgttttaggt |
194 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4633858 |
tgattgttgagtttgatgttgatctgtttttataggctgcagttgcacattttctaaatagatataaaaatgtggcatcgtaattggatttgttttaggt |
4633759 |
T |
 |
| Q |
195 |
ttttcttgatgaatatttgggttttgtttgtgtttcagtaccatccaga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4633758 |
ttttcttgatgaatatttgggttttgtttgtgtttcagtaccatccaga |
4633710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 660296 - 660190
Alignment:
| Q |
8 |
ataagatggttggcatttaacttgaacaccataagtgactga----tgcttttgtaggtgcaatgtacagaaaggaatgaaagcactaactgatgctttt |
103 |
Q |
| |
|
|||| ||| |||||||||| ||||||||| |||||||| ||| | |||||||| | |||||||||| ||| ||||| ||||||| |||||||||||| |
|
|
| T |
660296 |
ataaaatgcttggcattta-cttgaacactataagtgaatgaccgatccttttgtaagcgcaatgtacaaaaatgaatgtaagcactgactgatgctttt |
660198 |
T |
 |
| Q |
104 |
gttttgat |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
660197 |
gttttgat |
660190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 113 - 148
Target Start/End: Complemental strand, 660175 - 660140
Alignment:
| Q |
113 |
ttgatatgtttttataggctgcagttgcacattttc |
148 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
660175 |
ttgatctgtttttataggctgcagttgcacattttc |
660140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University