View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5753_high_6 (Length: 235)
Name: NF5753_high_6
Description: NF5753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5753_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 50574652 - 50574449
Alignment:
| Q |
19 |
aagaagtggtttgtgatcacgtaatgccatgtgccttttggttcattgtagattctttcatctgctccgttttgatatcataagcagcagtgatactgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50574652 |
aagaagtggtttgtgatcacgtaatgccatgtgccttttggttcattgtagattctttcatctgctccgttttgatatcataagcagcagtgatactgat |
50574553 |
T |
 |
| Q |
119 |
agtgatgcttaattact---actatatgactcggtccaaaagtgaagttaaccatatctactataccactaaattgttggcaagattacgttctttgaac |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50574552 |
agtgatgcttaattactactactatatgactcggtccaaaagtgaagttaaccatatctactataccactgaattgttggcaagattacgttctttgaac |
50574453 |
T |
 |
| Q |
216 |
ttag |
219 |
Q |
| |
|
|||| |
|
|
| T |
50574452 |
ttag |
50574449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University