View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5754-Insertion-3 (Length: 183)

Name: NF5754-Insertion-3
Description: NF5754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5754-Insertion-3
NF5754-Insertion-3
[»] chr3 (5 HSPs)
chr3 (8-183)||(30202989-30203164)
chr3 (10-183)||(30223843-30224016)
chr3 (10-183)||(30230839-30231012)
chr3 (77-183)||(30240123-30240229)
chr3 (65-169)||(29649622-29649726)
[»] chr7 (2 HSPs)
chr7 (79-179)||(16643995-16644095)
chr7 (79-179)||(17618356-17618456)
[»] chr2 (1 HSPs)
chr2 (65-113)||(6046754-6046802)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 8 - 183
Target Start/End: Original strand, 30202989 - 30203164
Alignment:
8 gtccactttggatatcactaaaatttagcagcatgttcagcaaagacattgagttgaatgatgacgcaattgctattgcaaaaaccatgcctaagttacg 107  Q
    ||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30202989 gtccacttttgatatcactaaaatttagcaggatgttctgcaaagacattgagttgaatgatgacgcaattgctattgcaaaaaccatgcctaagttacg 30203088  T
108 ccatctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttgatggatgtccccttcttgaa 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30203089 ccatctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttgatggatgtccccttcttgaa 30203164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 10 - 183
Target Start/End: Original strand, 30223843 - 30224016
Alignment:
10 ccactttggatatcactaaaatttagcagcatgttcagcaaagacattgagttgaatgatgacgcaattgctattgcaaaaaccatgcctaagttacgcc 109  Q
    ||||||| || |||| ||||||||||||| |||||||| |||||||| |||||||||||||||||  |||||||||||||||||||||||||| |||| |    
30223843 ccacttttgaaatcattaaaatttagcagaatgttcagtaaagacatcgagttgaatgatgacgcttttgctattgcaaaaaccatgcctaagctacgtc 30223942  T
110 atctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttgatggatgtccccttcttgaa 183  Q
    |||||||||||||||||||||| || ||||||||||| |||||||||||||||||||| || ||||||||||||    
30223943 atctttcgatgtttggaaacttgcttactaatgtcgggttgcatgccattcttgatggttgcccccttcttgaa 30224016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 10 - 183
Target Start/End: Original strand, 30230839 - 30231012
Alignment:
10 ccactttggatatcactaaaatttagcagcatgttcagcaaagacattgagttgaatgatgacgcaattgctattgcaaaaaccatgcctaagttacgcc 109  Q
    ||||||| || |||| ||||||||||||| ||||||||||||||||| ||| |||||||||||||  |||||||||||||||||||| ||||||||||||    
30230839 ccacttttgaaatcaataaaatttagcagaatgttcagcaaagacatcgagctgaatgatgacgcttttgctattgcaaaaaccatgactaagttacgcc 30230938  T
110 atctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttgatggatgtccccttcttgaa 183  Q
    |||||||||||||||||||||| || |||||||| || |||||||||||||||||||| || ||||||||||||    
30230939 atctttcgatgtttggaaacttgcttactaatgttgggttgcatgccattcttgatggttgcccccttcttgaa 30231012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 77 - 183
Target Start/End: Original strand, 30240123 - 30240229
Alignment:
77 ttgctattgcaaaaaccatgcctaagttacgccatctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttgatggatgtcccct 176  Q
    ||||||||||||| |||||||||||| |||||| ||||  ||| |||||||||| |||||||||||| || |||| | |||||||||||| ||| || ||    
30240123 ttgctattgcaaacaccatgcctaagctacgccttcttatgatttttggaaactcactcactaatgttgggttgctttccattcttgatgcatgccctct 30240222  T
177 tcttgaa 183  Q
    |||||||    
30240223 tcttgaa 30240229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 65 - 169
Target Start/End: Original strand, 29649622 - 29649726
Alignment:
65 atgatgacgcaattgctattgcaaaaaccatgcctaagttacgccatctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttga 164  Q
    ||||||| ||||||||| ||| |||||||||| ||||| |||| ||| ||  ||| | || ||| || ||||||||||  ||||||| ||||||||||||    
29649622 atgatgaggcaattgctgttggaaaaaccatgactaagctacgacatattaagatttatgaaaatttgctcactaatgatggattgcttgccattcttga 29649721  T
165 tggat 169  Q
    |||||    
29649722 tggat 29649726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000004; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 79 - 179
Target Start/End: Complemental strand, 16644095 - 16643995
Alignment:
79 gctattgcaaaaaccatgcctaagttacgccatctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttgatggatgtccccttc 178  Q
    |||||||||||||||||||||||| | ||| ||||||| ||| ||||||||  |||||||||||  |  |||| || |||||||||| |||| || ||||    
16644095 gctattgcaaaaaccatgcctaagcttcgctatctttcaatgattggaaacacactcactaatgatgagttgcttgtcattcttgatcgatgccctcttc 16643996  T
179 t 179  Q
    |    
16643995 t 16643995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 79 - 179
Target Start/End: Complemental strand, 17618456 - 17618356
Alignment:
79 gctattgcaaaaaccatgcctaagttacgccatctttcgatgtttggaaacttactcactaatgtcggattgcatgccattcttgatggatgtccccttc 178  Q
    |||||||||||||||||||||||| | ||| ||||||| ||| ||||||||  |||||||||||  |  |||| || |||||||||| |||| || ||||    
17618456 gctattgcaaaaaccatgcctaagcttcgctatctttcaatgattggaaacacactcactaatgatgagttgcttgtcattcttgatcgatgccctcttc 17618357  T
179 t 179  Q
    |    
17618356 t 17618356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 65 - 113
Target Start/End: Original strand, 6046754 - 6046802
Alignment:
65 atgatgacgcaattgctattgcaaaaaccatgcctaagttacgccatct 113  Q
    ||||||| ||| || ||||||||||||||||||||  ||||||||||||    
6046754 atgatgaggcattttctattgcaaaaaccatgcctgggttacgccatct 6046802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University