View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5754_low_3 (Length: 203)
Name: NF5754_low_3
Description: NF5754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5754_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 35 - 190
Target Start/End: Complemental strand, 21566449 - 21566294
Alignment:
| Q |
35 |
gaacctgtgactatcagttgattattggctttatttattgttgcattacttaaaaataaatttaataatagtttaatctgatagtgtcaactatcagttg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21566449 |
gaacctgtgactatcagttgattattggctttatttattgttgtattacttaaaaataaatttaataatagtttaatctgatagtgtcaactatcagttg |
21566350 |
T |
 |
| Q |
135 |
ctacaaaacatttaatattgcctataatattactagaatgtcgtcgtgtctctgat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
21566349 |
ctacaaaacatttaatattgcctataatattactagcatgtcgtcgtgtctgtgat |
21566294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University