View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5756-Insertion-1 (Length: 125)
Name: NF5756-Insertion-1
Description: NF5756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5756-Insertion-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 12662606 - 12662489
Alignment:
| Q |
8 |
gtaaccattggattgatgttcgttcttgtaacatgcaagtgttccagattctaaaatctttattggttaatattcacgatcctttggtgccttgtatcaa |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12662606 |
gtaaccaatggattgatgttcgttcttgtaacatgcaagtgttccagattctaaaatctttattggttaatattcacgatcctttggtgccttgtatcaa |
12662507 |
T |
|
| Q |
108 |
gaaggttttttggcatcc |
125 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12662506 |
cgaggttttttggcatcc |
12662489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University