View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5756-Insertion-3 (Length: 253)
Name: NF5756-Insertion-3
Description: NF5756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5756-Insertion-3 |
 | |
|
| [»] scaffold0148 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0148 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 63 - 243
Target Start/End: Complemental strand, 26892 - 26712
Alignment:
| Q |
63 |
aaggtaaacaagtgttattatgttctttgcatatttttcagcacctatatcctctcctacttctacaaaagagccaaacagagagaagtctaaaagctta |
162 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26892 |
aaggtaaaagagtgttattaagttctttgcataattttcagcacctagatcctctcctactgctacaaaagagccaaacagagagaagtctaaaagctta |
26793 |
T |
|
| Q |
163 |
ttctatttgattctgggcttatcacttttcggcgtagttgctctagtaggcatcattatttttgcttatgcatccagagga |
243 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
26792 |
ttctatttgattctgggcttatctcttttcggcgtagttgctctagttggcatcattatttttgcttatgcatgcagagga |
26712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0148; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 26918 - 26885
Alignment:
| Q |
8 |
gaatttggattatagctgaagttgaaaaggtaaa |
41 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
26918 |
gaatttggattatagctgaagttaaaaaggtaaa |
26885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University