View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5756-Insertion-4 (Length: 234)
Name: NF5756-Insertion-4
Description: NF5756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5756-Insertion-4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 40849757 - 40849984
Alignment:
| Q |
7 |
aatgagaaacacatttataaatctaaccaacatatttgtgtattctattttgacacaagcaattttggtttcaaattaatcaaacttataattaatgtgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40849757 |
aatgagaaacacatttataaatctaaccaacatatttgtgtattctattttgacacaagcaattttggtttcaaattaatcaaacttataattaatgtgc |
40849856 |
T |
 |
| Q |
107 |
ttcagttaaggacaaattatttaagagagccagacttcaaattctgattagatttattgcagaactttacttactttccacccaaacacttgattgcccg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40849857 |
ttcagttaaggacaaattatttaagagagccggacttcaaattctgattagatttattgcagaactttacttactttccacccaaacacttgattgcccg |
40849956 |
T |
 |
| Q |
207 |
gttccccttgggaactggtggactaaca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40849957 |
gttccccttgggaactggtggactaaca |
40849984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University