View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5757-Insertion-12 (Length: 198)
Name: NF5757-Insertion-12
Description: NF5757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5757-Insertion-12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 29056024 - 29055839
Alignment:
| Q |
13 |
tggagtaaattggggttggtttgtctttttcaaattttggttttcaacaggtatcttctattggaggcaatcctatttgaggcaaagttgaacactaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29056024 |
tggagtaaattggggttggtttgtctttttcaaattttggttttcaacaggtatcttctattggaggcaatcctatttgaggcaaagttgaacactaaat |
29055925 |
T |
|
| Q |
113 |
gtgagtacctctcccaacggggatctgaaccttggttcaccatgttatgggtgtccgggttggctttagcaaacaattttgactaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29055924 |
gtgagtacctctcccaacggggatctgaaccttggaccaccatgttatgggtgtccggtttggctttagcaaacaattttgactaa |
29055839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University