View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5757-Insertion-7 (Length: 366)
Name: NF5757-Insertion-7
Description: NF5757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5757-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 8 - 349
Target Start/End: Complemental strand, 25452788 - 25452447
Alignment:
| Q |
8 |
ctttgttgtgaagatatgtagtatctagtttagcagggtaaacagtatcatcatcgtcatcatctcattcttcaacactagaacttgccacatgccactt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25452788 |
ctttgttgtgaagatatgtagtatctagtttagcagggtaaacagtatcatcatcgtcatcatctcattcttcaacactagaacttgccacatgccactt |
25452689 |
T |
|
| Q |
108 |
gggagaaattggcctaataccttttctctactgggtacctaaaagtgctgatttttctgtacaagcatcttcttggtgtgaatggatggtatttggtata |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25452688 |
gggagaaattggcctaataccttttctcttctgcgtacctaaaagtgctgatttttctgtacaagcatcttcttggtgtgaatggatggtatttggtata |
25452589 |
T |
|
| Q |
208 |
ctgagtaaaatatgtcagttataccgccagtgaacactcccactgtgtcagtttttggtataaataccaaattttttaactactatagttaatttaggtt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25452588 |
ctgagtaaaatatgtcagttataccgccagtgaacactcccactgtgtcagtttttggtataaataccaaaaattttaactactatagttaatttaggtt |
25452489 |
T |
|
| Q |
308 |
ccatgcccaaaacatttttctgaaccagtcatttcatttcat |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25452488 |
ccatgcccaaaacatttttctcaaccagtcatttcatttcat |
25452447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University