View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5757_high_11 (Length: 282)
Name: NF5757_high_11
Description: NF5757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5757_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 29354517 - 29354762
Alignment:
| Q |
1 |
tttgattgaggcaattcaacttggtgcttttcagaaacttttggttatgttgcaagttgggtgtgaggagaaaacaaaggagaatactactgagttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29354517 |
tttgattgaggcaattcaacttggtgcttttcagaaacttttggttatgttgcaagttgggtgtgaggagaaaacaaaggagaatactactgagttgttg |
29354616 |
T |
 |
| Q |
101 |
aaattgttgaatggttatagaagcaaagctgaatgtgttgataattcattagatttcaagtatctcaagaactaagaagcctttctaaatactgattcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29354617 |
aaattgttgaatggttatagaagcaaagctgaatgtgttgataattcattagatttcaagtatctcaagaactaagaagcctttctaaatactgattcaa |
29354716 |
T |
 |
| Q |
201 |
gannnnnnnnnngatgaatactcatgagaatgagattcattcatttc |
247 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29354717 |
gagatttttttt-atgaatactcatgagaatgagattcattcatttc |
29354762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 33090058 - 33090199
Alignment:
| Q |
1 |
tttgattgaggcaattcaacttggtgcttttcagaaacttttggttatgttgcaagttgggtgtgaggagaaaacaaaggagaatactactgagttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | ||| |||||||||| || |||| |||| || |||||||| ||||||| |||||| |
|
|
| T |
33090058 |
tttgattgaggcaattcaacttgggatgtttcagaaactacttgttttgttgcaagtaggttgtgctgagagtaccaaggagaaagctactgaattgttg |
33090157 |
T |
 |
| Q |
101 |
aaattgttgaatggttatagaagcaaagctgaatgtgttgat |
142 |
Q |
| |
|
||||||||||| ||||||| ||||||||| || ||||||||| |
|
|
| T |
33090158 |
aaattgttgaacggttataaaagcaaagcagagtgtgttgat |
33090199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University