View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5757_high_13 (Length: 249)
Name: NF5757_high_13
Description: NF5757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5757_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 32162880 - 32162666
Alignment:
| Q |
16 |
aatatcacgtaattgagacgctgttttaagcagaatggagaaaacgacgaggtcgttgaaggaaccgagagtggttcgcgcaaggttgtagaatgaaacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162880 |
aatatcacgtaattgagacgctgttttaagcagaatggagaaaacgacgaggtcgttgaaggaaccgagagtggttcgcgcaaggttgtagaatgaaacg |
32162781 |
T |
|
| Q |
116 |
acgtgggagtggatgtcgttaaggaaatgccaacgaatgatgagtttgaaggagtggtgggttggtgagggaagacggtggaagagagtgcgagcgtggc |
215 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162780 |
acgtgggagtggacgtcgttgaggaaatgccaacgaatgatgagtttgaaggagtggtgggttggtgagggaagacggtggaagagagtgcgagcgtggc |
32162681 |
T |
|
| Q |
216 |
ggaggaagccgaagg |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32162680 |
ggaggaagccgaagg |
32162666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University