View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5757_high_14 (Length: 249)
Name: NF5757_high_14
Description: NF5757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5757_high_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 24166453 - 24166691
Alignment:
| Q |
11 |
atgaacggtcaaaacactgcaatacgatcggatcaataattttatcaaataaaaatctgattgttattatttaaccatctatattcatgaagatgaaaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24166453 |
atgaacggtcaaaacactgcaatacgatcagatcaataattttatcaaataaaaatctgattgttattatttaaccatctatattcatgaagatgaaaat |
24166552 |
T |
|
| Q |
111 |
ttggtcctctacaatcgactttatggtgcagccggctgtagaggattcaagtcagtgaagatggaattttacctatgagaacggctgcttctctcattta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24166553 |
ttggtcctctacaatcgactttatggtgcagccggctgtagatgattcaagtcagtgaagatggaattttacctatgagaacggctgcttctctcattta |
24166652 |
T |
|
| Q |
211 |
gggctgtagcacctacagcgcggtttttctgaccaattc |
249 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
24166653 |
gggctgtagcaccaacagtgcggtttttctgaccaattc |
24166691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 176 - 248
Target Start/End: Original strand, 42234324 - 42234396
Alignment:
| Q |
176 |
attttacctatgagaacggctgcttctctcatttagggctgtagcacctacagcgcggtttttctgaccaatt |
248 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||| || |||||||| ||||| || || ||||||||||| |
|
|
| T |
42234324 |
attttacctatgagaacgactgcttcgctcatttagagcggtagcaccaacagcacgattcctctgaccaatt |
42234396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University