View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5758_low_4 (Length: 255)
Name: NF5758_low_4
Description: NF5758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5758_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 22644831 - 22644604
Alignment:
| Q |
19 |
catagcccgtccacatcatgtttttacagcagttcagagcaacaagttcaactactctgtcagcatcacgagttactgccgacagtccctaacccccgtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22644831 |
catagcccgtccacatcatgtttttacagcagttcagagcaacaagttcaactactctgtcagcatcacgagttactgctgacagtccctaacccccgtc |
22644732 |
T |
|
| Q |
119 |
tgctgcaccgggaatatcatatccgtcaaagcactcttgttcctatttttccatacgtcataatacatggataggactgatttaatcacatgctccgatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644731 |
tgctgcaccgggaatatcatatccgtcaaagcactcttgttcctatttttccatacgtcataatacatggataggactgatttaatcacatgctccgatt |
22644632 |
T |
|
| Q |
219 |
cactcacaatcctttgttcatctcactc |
246 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |
|
|
| T |
22644631 |
cactcacaatcccttgttcatcccactc |
22644604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University