View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5759_high_21 (Length: 351)
Name: NF5759_high_21
Description: NF5759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5759_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 10 - 333
Target Start/End: Original strand, 17594381 - 17594704
Alignment:
| Q |
10 |
acatcatcaacggctaccaatctctcctttgaccagctcacttcttgtgatccgtctgatgggagggaggatccagcacagtaacgtatgcatcccacct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17594381 |
acatcatcaacggctaccaatctctcctttgaccagctcacttcttgtgatccgtctgatgggagggagaatccagcacagtaacgtatgcatcccacct |
17594480 |
T |
 |
| Q |
110 |
caccgttggatccgtggataccgtaacatgtggcgaggttagggaagcgtttgtggagattgaaaaagtctttgataagtggccatgcttgttgttttgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17594481 |
caccgttggatccgtggataccgtaacatgtggcgaggttagggaagcgtttgtggagattgaaaaagtctttgatgagtggccatgcttgttgttttgt |
17594580 |
T |
 |
| Q |
210 |
ggtgtttttgagtttggttgaaactttggcttcccatctttgaataatgttttgttccatttttgtgtgcaaaggatacaaagctgaatgatgagattcc |
309 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594581 |
ggtgtttttcagtttggttgaaactttggcttcccatctttgaataatgttttgttccatttttgtgtgcaaaggatacaaagctgaatgatgagattcc |
17594680 |
T |
 |
| Q |
310 |
actcaatttcaccctccaccacta |
333 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
17594681 |
actcaatttcaccctccaccacta |
17594704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University